Search…
qPCR
What primer/probe sequences did you use to quantify the final PCR library with qPCR before submitting to sequencing?
We use Invitrogen Platinum qPCR Supermix w/ROX and these primers:
DLP: [6FAM] CCCTACACGACGCTCTTCCGATCT [TAMRA]
Primer 1: AATGATACGGCGACCACCGAGATC
Primer 2: CAAGCAGAAGACGGCATACGAGATC
Last modified 4mo ago
Copy link