qPCR

What primer/probe sequences did you use to quantify the final PCR library with qPCR before submitting to sequencing?

We use Invitrogen Platinum qPCR Supermix w/ROX and these primers:

DLP: [6FAM] CCCTACACGACGCTCTTCCGATCT [TAMRA]

Primer 1: AATGATACGGCGACCACCGAGATC

Primer 2: CAAGCAGAAGACGGCATACGAGATC